Review



ha tag c29f4 rabbit mab cell signaling technology 3724s wb  (Cell Signaling Technology Inc)


Bioz Verified Symbol Cell Signaling Technology Inc is a verified supplier
Bioz Manufacturer Symbol Cell Signaling Technology Inc manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86

    Structured Review

    Cell Signaling Technology Inc ha tag c29f4 rabbit mab cell signaling technology 3724s wb
    Ha Tag C29f4 Rabbit Mab Cell Signaling Technology 3724s Wb, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/c29f4+cell+signaling+technology/pm41736094-318-56-60
    Average 86 stars, based on 1 article reviews
    ha tag c29f4 rabbit mab cell signaling technology 3724s wb - by Bioz Stars, 2026-09
    86/100 stars

    Images

    Related Articles

    Produced:

    Article Title:
    Article Snippet: DMEM Thermo Fisher Scientific Cat# 11965092 DMEM/F12 Thermo Fisher Scientific Cat# 11320033 Opti-MEM Thermo Fisher Scientific Cat# 31985070 TrypLETM Express Thermo Fisher Scientific Cat# 12605093 GlutaMAXTM Supplement Thermo Fisher Scientific Cat# 35050061 FBS Bovogen Biologicals SFBS-AU Antibiotic-Antimycotic Thermo Fisher Scientific Cat# 15240062 DPBS Thermo Fisher Scientific Cat# 14190250 LipofectamineTM 3000 Transfection Reagent Thermo Fisher Scientific Cat# L3000001 ViaFectTM Transfection Reagent Promega Corporation Cat# E4982 NEB® Stable Competent E. coli New England Biolabs Cat# C3040I rCutSmartTM Buffer New England Biolabs Cat# B6004S NEB® 10-beta/Stable Outgrowth Medium New England Biolabs Cat# B9035S NucBlueTM Live ReadyProbesTM Reagent (Hoechst 33342) Thermo Fisher Scientific Cat# R37605 LB (Lennox L) agar Thermo Fisher Scientific Cat# 22700025 2-YT Broth Thermo Fisher Scientific Cat# 22712020 Carbenicillin Disodium Salt Thermo Fisher Scientific Cat# 10177012 GelRed® nucleic acid gel stain Biotium Cat# 41003 Phosphate buffered saline Merck Cat# P3813 Tween-20 Merck Cat# P1379 Triton-X-100 Amresco Cat# 0694 RIPA Lysis and Extraction Buffer Thermo Fisher Scientific Cat# 89900 PierceTM Phosphatase Inhibitor Mini Tablets Thermo Fisher Scientific Cat# A32957 NuPAGETM MES SDS Running Buffer (20X) Thermo Fisher Scientific Cat# NP0002 NuPAGETM LDS Sample Buffer (4X) Thermo Fisher Scientific Cat# NP0007 (AlcaineTM) Alcon N/A 0.5% Tropicamide (Mydriacyl) Alcon N/A GenTealTM Gel Alcon N/A Ketamine, 100 mg/mL Troy Laboratories Ketamil Xylazine, 100 mg/mL Troy Laboratories Ilium Xylazil-100 Experimental models- Cell lines and Mouse HEK293FT Thermo Fisher Scientific R70007 hESC WA09 (H9 ESCs) WiCell (1) Kimba Mouse The Lions Eye Institute (2) .. Mouse anti-actin, clone C4 Merck MAB1501 Rabbit anti-HA, C29F4 Cell Signaling Technology #3724 Mouse anti-rhodopsin, 1D4 Abcam ab5417 Rat mCherry monoclonal 16D7, Alexa FluorTM 594 Thermo Fisher Scientific Cat# M11240 Rat anti-laminin monoclonal, α-2 chain Merck L0663 Donkey anti-rat AffiniPure Fragment IgG (H + L), Alexa FluorTM 647 Jackson ImmunoResearch 712-606-150 Donkey mouse AffiniPure Fragment IgG (H + L), Alexa FluorTM Jackson ImmunoResearch 715-546-151 Goat anti-rabbit IgG (H+L) Secondary Antibody, HRP Thermo Fisher Scientific Cat# 31460 Goat anti-Mouse IgG (H+L) Secondary Antibody, HRP Thermo Fisher Scientific Cat# 62-6520 Anti-Arrestin C antibody, C-terminal Abcam 189437 Monoclonal Anti-Opsin antibody produced in mouse Merck O4886 Sheep anti Human chx 10 (Visual system homeobox 2) (NT) ExAlpha XII80P CRALBP Monoclonal Antibody (B2) Thermo Fisher Scientific MA1-813 Anti-Prox 1 Antibody Merck AB5475 (16A11) Thermo Fisher Scientific A21271 .. RNeasy Mini kit Qiagen Cat# 74106 Monarch® Total RNA Miniprep Kit New England Biolabs Cat# T2010S High-Capacity cDNA Reverse Transcription Kit Thermo Fisher Scientific Cat# 4368814 Q5® Hot Start High-Fidelity Master Mix New England Biolabs Cat# M0494S TaqManTM Fast Advanced Master Mix Thermo Fisher Scientific Cat# 4444557 SYBRTM Green PCR Master Mix Thermo Fisher Scientific Cat# 4309155 Human VEGF DuoSet ELISA R&D systems Cat# DY293B Plasmid DNA pAAV.CMV.CasRx-mCh Addgene 203442 pAAV.U6.

    Recombinant:

    Article Title: Resolution of R-loops by topoisomerase III-β (TOP3B) in coordination with the DEAD-box helicase DDX5.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Monoclonal ANTI-FLAG M2 Mouse Monoclonal antibody, Sigma-Aldrich Sigma-Aldrich Cat# F1804; RRID: AB_262044 Anti-GAPDH Rabbit Monoclonal Antibody, Unconjugated, Clone 14C10 Cell Signaling Technology Cat# 2118; RRID: AB_561053 Anti-TOP3B Rabbit Monoclonal antibody [EP7779] - C-terminal (ab183520) Abcam RRID: AB_183520 Rabbit Anti-HA-Tag Monoclonal Antibody, Unconjugated, Clone C29F4 Cell Signaling Technology Cat# 3724; RRID: AB_1549585 Sheep Anti-Mouse IgG ECL Antibody, HRP Conjugated, GE Healthcare GE Healthcare Cat# NA9310-1mL; RRID: AB_772193 Donkey Anti-Rabbit IgG ECL Antibody, HRP Conjugated, GE Healthcare GE Healthcare Cat# NA9340-1mL; RRID: AB_772191 Anti-dsRNA monoclonal antibody J2 (mouse, IgG2a, kappa chain) Jena Bioscience Cat# RNT-SCI-10010200; RRID: AB_2651015 Anti-DNA-RNA Hybrid Antibody, clone S9.6 Millipore Sigma Cat# MABE1095; RRID: AB_2861387 Recombinant Anti-DDX5 antibody [EPR7239] (ab126730) Abcam RRID: AB_126730 Recombinant Anti-Senataxin antibody [BLR050F] - BSA free (ab243904) Abcam Cat# ab243904; RRID: AB_2893218 TDRD3 (D3O2G) Rabbit mAb #5942 Cell Signaling Technology Cat# 5942; RRID: AB_2797626 HDAC1 (D5C6U) XP Rabbit mAb #34589 Cell Signaling Technology Cat# 34589S; RRID: AB_2756821 Histone H3 Rabbit Antibody #9715 Cell Signaling Technology Cat# 9715S; RRID: AB_331563 Bacterial and virus strains NEB 5-alpha Competent E. coli (High Efficiency) NEW ENGLAND BioLabs Inc. Cat# C2987H MAX EfficiencyTM DH10B Competent Cells ThermoFisher Scientific Cat# 18297010 DE77, a DH10Bac-derived strain Bac-to-Bac system, Thermo Fisher N/A Chemicals, peptides, and recombinant proteins DMEM - Dulbecco’s Modified Eagle Medium ThermoFisher Scientific Cat# 11965-092 Fetal Bovine Serum Gemini Cat# 100-106 Penicillin-Streptomycin ThermoFisher Scientific Cat# 15140-122 Trypsin-EDTA (0.05%) ThermoFisher Scientific Cat# 25300054 cOmplete Mini, EDTA-free (protease inhibitor cocktail) Roche Cat# 11836170001 Recombinant Human TOP3B (Saha et al., 2020) N/A PEI Polysciences Cat# 23966 Lipofectamine 3000 Reagent ThermoFisher Scientific Cat# L3000015 Lipofectamine RNAiMAX transfection reagent ThermoFisher Scientific Cat# 13778150 Benzonase Sigma-Aldrich Cat# E8263 PierceTM ChIP-grade Protein A/G Magnetic Beads ThermoFisher Scientific Cat# 26162 Tris-glycine SDS sample buffer Novex Cat# LC2676 SuperSignalTM West Femto Maximum Sensitivity Substrate ThermoFisher Scientific Cat# 34095 (Continued on next page) e1 Cell Reports 40, 111067, July 12, 2022 .. REAGENT or RESOURCE SOURCE IDENTIFIER TRIzolTM Reagent ThermoFisher Scientific Cat# 15596026 Micrococcal Nuclease Solution (R100 U/mL) ThermoFisher Scientific Cat# 88216 RNase A ThermoFisher Scientific Cat# EN0531 RNase T1 ThermoFisher Scientific Cat# EN0542 RNase H New England Biolabs Cat# M0297L ShortCut RNase III New England BioLabs Cat# M0245L InvitrogenTM TURBOTM DNase (2 U/mL) ThermoFisher Scientific Cat# AM2238 N-Ethylmaleimide Millipore Sigma Cat# E3876-25G DNAzol ThermoFisher Scientific Cat# 10503027 Glycogen, RNA grade ThermoFisher Scientific Cat# R0551 InvitrogenTM Proteinase K Solution ThermoFisher Scientific Cat# 4333793 InvitrogenTM Proteinase K Solution (20 mg/mL), RNA grade ThermoFisher Scientific Cat# 25530049 N-Lauroylsarcosine sodium salt Millipore Sigma Cat# L9150 Camptothecin (CPT) Developmental Therapeutics Program (NCI/NIH) NSC#94600 Pladienolide B, 0.5 mg (CAS 445493-23-2) Santa Cruz Biotechnology Cat# sc-391691 GibcoTM Hygromycin B (50mg/mL) ThermoFisher Scientific Cat# 10-687-010 DDX5 (NM_004396) Human Recombinant Protein OriGene Cat# TP300371 Mini Quick Spin Oligo Columns Millipore Sigma Cat# 11814397001 Critical commercial assays MycoAlert kit - 100 tests Lonza Cat# LT07-318 Deposited data Original imaging data This paper: Mendeley Data https://data.mendeley.com/ datasets/htjp2m4sdb/draft? a=f39bb027-f618-4d44-a18b2c36fae27413 Experimental models: Cell lines HEK293 ATCC CRL-1573 HCT116 Developmental Therapeutics Program (NCI/NIH) N/A

    Virus:

    Article Title: Resolution of R-loops by topoisomerase III-β (TOP3B) in coordination with the DEAD-box helicase DDX5.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Monoclonal ANTI-FLAG M2 Mouse Monoclonal antibody, Sigma-Aldrich Sigma-Aldrich Cat# F1804; RRID: AB_262044 Anti-GAPDH Rabbit Monoclonal Antibody, Unconjugated, Clone 14C10 Cell Signaling Technology Cat# 2118; RRID: AB_561053 Anti-TOP3B Rabbit Monoclonal antibody [EP7779] - C-terminal (ab183520) Abcam RRID: AB_183520 Rabbit Anti-HA-Tag Monoclonal Antibody, Unconjugated, Clone C29F4 Cell Signaling Technology Cat# 3724; RRID: AB_1549585 Sheep Anti-Mouse IgG ECL Antibody, HRP Conjugated, GE Healthcare GE Healthcare Cat# NA9310-1mL; RRID: AB_772193 Donkey Anti-Rabbit IgG ECL Antibody, HRP Conjugated, GE Healthcare GE Healthcare Cat# NA9340-1mL; RRID: AB_772191 Anti-dsRNA monoclonal antibody J2 (mouse, IgG2a, kappa chain) Jena Bioscience Cat# RNT-SCI-10010200; RRID: AB_2651015 Anti-DNA-RNA Hybrid Antibody, clone S9.6 Millipore Sigma Cat# MABE1095; RRID: AB_2861387 Recombinant Anti-DDX5 antibody [EPR7239] (ab126730) Abcam RRID: AB_126730 Recombinant Anti-Senataxin antibody [BLR050F] - BSA free (ab243904) Abcam Cat# ab243904; RRID: AB_2893218 TDRD3 (D3O2G) Rabbit mAb #5942 Cell Signaling Technology Cat# 5942; RRID: AB_2797626 HDAC1 (D5C6U) XP Rabbit mAb #34589 Cell Signaling Technology Cat# 34589S; RRID: AB_2756821 Histone H3 Rabbit Antibody #9715 Cell Signaling Technology Cat# 9715S; RRID: AB_331563 Bacterial and virus strains NEB 5-alpha Competent E. coli (High Efficiency) NEW ENGLAND BioLabs Inc. Cat# C2987H MAX EfficiencyTM DH10B Competent Cells ThermoFisher Scientific Cat# 18297010 DE77, a DH10Bac-derived strain Bac-to-Bac system, Thermo Fisher N/A Chemicals, peptides, and recombinant proteins DMEM - Dulbecco’s Modified Eagle Medium ThermoFisher Scientific Cat# 11965-092 Fetal Bovine Serum Gemini Cat# 100-106 Penicillin-Streptomycin ThermoFisher Scientific Cat# 15140-122 Trypsin-EDTA (0.05%) ThermoFisher Scientific Cat# 25300054 cOmplete Mini, EDTA-free (protease inhibitor cocktail) Roche Cat# 11836170001 Recombinant Human TOP3B (Saha et al., 2020) N/A PEI Polysciences Cat# 23966 Lipofectamine 3000 Reagent ThermoFisher Scientific Cat# L3000015 Lipofectamine RNAiMAX transfection reagent ThermoFisher Scientific Cat# 13778150 Benzonase Sigma-Aldrich Cat# E8263 PierceTM ChIP-grade Protein A/G Magnetic Beads ThermoFisher Scientific Cat# 26162 Tris-glycine SDS sample buffer Novex Cat# LC2676 SuperSignalTM West Femto Maximum Sensitivity Substrate ThermoFisher Scientific Cat# 34095 (Continued on next page) e1 Cell Reports 40, 111067, July 12, 2022 .. REAGENT or RESOURCE SOURCE IDENTIFIER TRIzolTM Reagent ThermoFisher Scientific Cat# 15596026 Micrococcal Nuclease Solution (R100 U/mL) ThermoFisher Scientific Cat# 88216 RNase A ThermoFisher Scientific Cat# EN0531 RNase T1 ThermoFisher Scientific Cat# EN0542 RNase H New England Biolabs Cat# M0297L ShortCut RNase III New England BioLabs Cat# M0245L InvitrogenTM TURBOTM DNase (2 U/mL) ThermoFisher Scientific Cat# AM2238 N-Ethylmaleimide Millipore Sigma Cat# E3876-25G DNAzol ThermoFisher Scientific Cat# 10503027 Glycogen, RNA grade ThermoFisher Scientific Cat# R0551 InvitrogenTM Proteinase K Solution ThermoFisher Scientific Cat# 4333793 InvitrogenTM Proteinase K Solution (20 mg/mL), RNA grade ThermoFisher Scientific Cat# 25530049 N-Lauroylsarcosine sodium salt Millipore Sigma Cat# L9150 Camptothecin (CPT) Developmental Therapeutics Program (NCI/NIH) NSC#94600 Pladienolide B, 0.5 mg (CAS 445493-23-2) Santa Cruz Biotechnology Cat# sc-391691 GibcoTM Hygromycin B (50mg/mL) ThermoFisher Scientific Cat# 10-687-010 DDX5 (NM_004396) Human Recombinant Protein OriGene Cat# TP300371 Mini Quick Spin Oligo Columns Millipore Sigma Cat# 11814397001 Critical commercial assays MycoAlert kit - 100 tests Lonza Cat# LT07-318 Deposited data Original imaging data This paper: Mendeley Data https://data.mendeley.com/ datasets/htjp2m4sdb/draft? a=f39bb027-f618-4d44-a18b2c36fae27413 Experimental models: Cell lines HEK293 ATCC CRL-1573 HCT116 Developmental Therapeutics Program (NCI/NIH) N/A

    Modification:

    Article Title: Resolution of R-loops by topoisomerase III-β (TOP3B) in coordination with the DEAD-box helicase DDX5.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Monoclonal ANTI-FLAG M2 Mouse Monoclonal antibody, Sigma-Aldrich Sigma-Aldrich Cat# F1804; RRID: AB_262044 Anti-GAPDH Rabbit Monoclonal Antibody, Unconjugated, Clone 14C10 Cell Signaling Technology Cat# 2118; RRID: AB_561053 Anti-TOP3B Rabbit Monoclonal antibody [EP7779] - C-terminal (ab183520) Abcam RRID: AB_183520 Rabbit Anti-HA-Tag Monoclonal Antibody, Unconjugated, Clone C29F4 Cell Signaling Technology Cat# 3724; RRID: AB_1549585 Sheep Anti-Mouse IgG ECL Antibody, HRP Conjugated, GE Healthcare GE Healthcare Cat# NA9310-1mL; RRID: AB_772193 Donkey Anti-Rabbit IgG ECL Antibody, HRP Conjugated, GE Healthcare GE Healthcare Cat# NA9340-1mL; RRID: AB_772191 Anti-dsRNA monoclonal antibody J2 (mouse, IgG2a, kappa chain) Jena Bioscience Cat# RNT-SCI-10010200; RRID: AB_2651015 Anti-DNA-RNA Hybrid Antibody, clone S9.6 Millipore Sigma Cat# MABE1095; RRID: AB_2861387 Recombinant Anti-DDX5 antibody [EPR7239] (ab126730) Abcam RRID: AB_126730 Recombinant Anti-Senataxin antibody [BLR050F] - BSA free (ab243904) Abcam Cat# ab243904; RRID: AB_2893218 TDRD3 (D3O2G) Rabbit mAb #5942 Cell Signaling Technology Cat# 5942; RRID: AB_2797626 HDAC1 (D5C6U) XP Rabbit mAb #34589 Cell Signaling Technology Cat# 34589S; RRID: AB_2756821 Histone H3 Rabbit Antibody #9715 Cell Signaling Technology Cat# 9715S; RRID: AB_331563 Bacterial and virus strains NEB 5-alpha Competent E. coli (High Efficiency) NEW ENGLAND BioLabs Inc. Cat# C2987H MAX EfficiencyTM DH10B Competent Cells ThermoFisher Scientific Cat# 18297010 DE77, a DH10Bac-derived strain Bac-to-Bac system, Thermo Fisher N/A Chemicals, peptides, and recombinant proteins DMEM - Dulbecco’s Modified Eagle Medium ThermoFisher Scientific Cat# 11965-092 Fetal Bovine Serum Gemini Cat# 100-106 Penicillin-Streptomycin ThermoFisher Scientific Cat# 15140-122 Trypsin-EDTA (0.05%) ThermoFisher Scientific Cat# 25300054 cOmplete Mini, EDTA-free (protease inhibitor cocktail) Roche Cat# 11836170001 Recombinant Human TOP3B (Saha et al., 2020) N/A PEI Polysciences Cat# 23966 Lipofectamine 3000 Reagent ThermoFisher Scientific Cat# L3000015 Lipofectamine RNAiMAX transfection reagent ThermoFisher Scientific Cat# 13778150 Benzonase Sigma-Aldrich Cat# E8263 PierceTM ChIP-grade Protein A/G Magnetic Beads ThermoFisher Scientific Cat# 26162 Tris-glycine SDS sample buffer Novex Cat# LC2676 SuperSignalTM West Femto Maximum Sensitivity Substrate ThermoFisher Scientific Cat# 34095 (Continued on next page) e1 Cell Reports 40, 111067, July 12, 2022 .. REAGENT or RESOURCE SOURCE IDENTIFIER TRIzolTM Reagent ThermoFisher Scientific Cat# 15596026 Micrococcal Nuclease Solution (R100 U/mL) ThermoFisher Scientific Cat# 88216 RNase A ThermoFisher Scientific Cat# EN0531 RNase T1 ThermoFisher Scientific Cat# EN0542 RNase H New England Biolabs Cat# M0297L ShortCut RNase III New England BioLabs Cat# M0245L InvitrogenTM TURBOTM DNase (2 U/mL) ThermoFisher Scientific Cat# AM2238 N-Ethylmaleimide Millipore Sigma Cat# E3876-25G DNAzol ThermoFisher Scientific Cat# 10503027 Glycogen, RNA grade ThermoFisher Scientific Cat# R0551 InvitrogenTM Proteinase K Solution ThermoFisher Scientific Cat# 4333793 InvitrogenTM Proteinase K Solution (20 mg/mL), RNA grade ThermoFisher Scientific Cat# 25530049 N-Lauroylsarcosine sodium salt Millipore Sigma Cat# L9150 Camptothecin (CPT) Developmental Therapeutics Program (NCI/NIH) NSC#94600 Pladienolide B, 0.5 mg (CAS 445493-23-2) Santa Cruz Biotechnology Cat# sc-391691 GibcoTM Hygromycin B (50mg/mL) ThermoFisher Scientific Cat# 10-687-010 DDX5 (NM_004396) Human Recombinant Protein OriGene Cat# TP300371 Mini Quick Spin Oligo Columns Millipore Sigma Cat# 11814397001 Critical commercial assays MycoAlert kit - 100 tests Lonza Cat# LT07-318 Deposited data Original imaging data This paper: Mendeley Data https://data.mendeley.com/ datasets/htjp2m4sdb/draft? a=f39bb027-f618-4d44-a18b2c36fae27413 Experimental models: Cell lines HEK293 ATCC CRL-1573 HCT116 Developmental Therapeutics Program (NCI/NIH) N/A

    Protease Inhibitor:

    Article Title: Resolution of R-loops by topoisomerase III-β (TOP3B) in coordination with the DEAD-box helicase DDX5.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Monoclonal ANTI-FLAG M2 Mouse Monoclonal antibody, Sigma-Aldrich Sigma-Aldrich Cat# F1804; RRID: AB_262044 Anti-GAPDH Rabbit Monoclonal Antibody, Unconjugated, Clone 14C10 Cell Signaling Technology Cat# 2118; RRID: AB_561053 Anti-TOP3B Rabbit Monoclonal antibody [EP7779] - C-terminal (ab183520) Abcam RRID: AB_183520 Rabbit Anti-HA-Tag Monoclonal Antibody, Unconjugated, Clone C29F4 Cell Signaling Technology Cat# 3724; RRID: AB_1549585 Sheep Anti-Mouse IgG ECL Antibody, HRP Conjugated, GE Healthcare GE Healthcare Cat# NA9310-1mL; RRID: AB_772193 Donkey Anti-Rabbit IgG ECL Antibody, HRP Conjugated, GE Healthcare GE Healthcare Cat# NA9340-1mL; RRID: AB_772191 Anti-dsRNA monoclonal antibody J2 (mouse, IgG2a, kappa chain) Jena Bioscience Cat# RNT-SCI-10010200; RRID: AB_2651015 Anti-DNA-RNA Hybrid Antibody, clone S9.6 Millipore Sigma Cat# MABE1095; RRID: AB_2861387 Recombinant Anti-DDX5 antibody [EPR7239] (ab126730) Abcam RRID: AB_126730 Recombinant Anti-Senataxin antibody [BLR050F] - BSA free (ab243904) Abcam Cat# ab243904; RRID: AB_2893218 TDRD3 (D3O2G) Rabbit mAb #5942 Cell Signaling Technology Cat# 5942; RRID: AB_2797626 HDAC1 (D5C6U) XP Rabbit mAb #34589 Cell Signaling Technology Cat# 34589S; RRID: AB_2756821 Histone H3 Rabbit Antibody #9715 Cell Signaling Technology Cat# 9715S; RRID: AB_331563 Bacterial and virus strains NEB 5-alpha Competent E. coli (High Efficiency) NEW ENGLAND BioLabs Inc. Cat# C2987H MAX EfficiencyTM DH10B Competent Cells ThermoFisher Scientific Cat# 18297010 DE77, a DH10Bac-derived strain Bac-to-Bac system, Thermo Fisher N/A Chemicals, peptides, and recombinant proteins DMEM - Dulbecco’s Modified Eagle Medium ThermoFisher Scientific Cat# 11965-092 Fetal Bovine Serum Gemini Cat# 100-106 Penicillin-Streptomycin ThermoFisher Scientific Cat# 15140-122 Trypsin-EDTA (0.05%) ThermoFisher Scientific Cat# 25300054 cOmplete Mini, EDTA-free (protease inhibitor cocktail) Roche Cat# 11836170001 Recombinant Human TOP3B (Saha et al., 2020) N/A PEI Polysciences Cat# 23966 Lipofectamine 3000 Reagent ThermoFisher Scientific Cat# L3000015 Lipofectamine RNAiMAX transfection reagent ThermoFisher Scientific Cat# 13778150 Benzonase Sigma-Aldrich Cat# E8263 PierceTM ChIP-grade Protein A/G Magnetic Beads ThermoFisher Scientific Cat# 26162 Tris-glycine SDS sample buffer Novex Cat# LC2676 SuperSignalTM West Femto Maximum Sensitivity Substrate ThermoFisher Scientific Cat# 34095 (Continued on next page) e1 Cell Reports 40, 111067, July 12, 2022 .. REAGENT or RESOURCE SOURCE IDENTIFIER TRIzolTM Reagent ThermoFisher Scientific Cat# 15596026 Micrococcal Nuclease Solution (R100 U/mL) ThermoFisher Scientific Cat# 88216 RNase A ThermoFisher Scientific Cat# EN0531 RNase T1 ThermoFisher Scientific Cat# EN0542 RNase H New England Biolabs Cat# M0297L ShortCut RNase III New England BioLabs Cat# M0245L InvitrogenTM TURBOTM DNase (2 U/mL) ThermoFisher Scientific Cat# AM2238 N-Ethylmaleimide Millipore Sigma Cat# E3876-25G DNAzol ThermoFisher Scientific Cat# 10503027 Glycogen, RNA grade ThermoFisher Scientific Cat# R0551 InvitrogenTM Proteinase K Solution ThermoFisher Scientific Cat# 4333793 InvitrogenTM Proteinase K Solution (20 mg/mL), RNA grade ThermoFisher Scientific Cat# 25530049 N-Lauroylsarcosine sodium salt Millipore Sigma Cat# L9150 Camptothecin (CPT) Developmental Therapeutics Program (NCI/NIH) NSC#94600 Pladienolide B, 0.5 mg (CAS 445493-23-2) Santa Cruz Biotechnology Cat# sc-391691 GibcoTM Hygromycin B (50mg/mL) ThermoFisher Scientific Cat# 10-687-010 DDX5 (NM_004396) Human Recombinant Protein OriGene Cat# TP300371 Mini Quick Spin Oligo Columns Millipore Sigma Cat# 11814397001 Critical commercial assays MycoAlert kit - 100 tests Lonza Cat# LT07-318 Deposited data Original imaging data This paper: Mendeley Data https://data.mendeley.com/ datasets/htjp2m4sdb/draft? a=f39bb027-f618-4d44-a18b2c36fae27413 Experimental models: Cell lines HEK293 ATCC CRL-1573 HCT116 Developmental Therapeutics Program (NCI/NIH) N/A

    Transfection:

    Article Title: Resolution of R-loops by topoisomerase III-β (TOP3B) in coordination with the DEAD-box helicase DDX5.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Monoclonal ANTI-FLAG M2 Mouse Monoclonal antibody, Sigma-Aldrich Sigma-Aldrich Cat# F1804; RRID: AB_262044 Anti-GAPDH Rabbit Monoclonal Antibody, Unconjugated, Clone 14C10 Cell Signaling Technology Cat# 2118; RRID: AB_561053 Anti-TOP3B Rabbit Monoclonal antibody [EP7779] - C-terminal (ab183520) Abcam RRID: AB_183520 Rabbit Anti-HA-Tag Monoclonal Antibody, Unconjugated, Clone C29F4 Cell Signaling Technology Cat# 3724; RRID: AB_1549585 Sheep Anti-Mouse IgG ECL Antibody, HRP Conjugated, GE Healthcare GE Healthcare Cat# NA9310-1mL; RRID: AB_772193 Donkey Anti-Rabbit IgG ECL Antibody, HRP Conjugated, GE Healthcare GE Healthcare Cat# NA9340-1mL; RRID: AB_772191 Anti-dsRNA monoclonal antibody J2 (mouse, IgG2a, kappa chain) Jena Bioscience Cat# RNT-SCI-10010200; RRID: AB_2651015 Anti-DNA-RNA Hybrid Antibody, clone S9.6 Millipore Sigma Cat# MABE1095; RRID: AB_2861387 Recombinant Anti-DDX5 antibody [EPR7239] (ab126730) Abcam RRID: AB_126730 Recombinant Anti-Senataxin antibody [BLR050F] - BSA free (ab243904) Abcam Cat# ab243904; RRID: AB_2893218 TDRD3 (D3O2G) Rabbit mAb #5942 Cell Signaling Technology Cat# 5942; RRID: AB_2797626 HDAC1 (D5C6U) XP Rabbit mAb #34589 Cell Signaling Technology Cat# 34589S; RRID: AB_2756821 Histone H3 Rabbit Antibody #9715 Cell Signaling Technology Cat# 9715S; RRID: AB_331563 Bacterial and virus strains NEB 5-alpha Competent E. coli (High Efficiency) NEW ENGLAND BioLabs Inc. Cat# C2987H MAX EfficiencyTM DH10B Competent Cells ThermoFisher Scientific Cat# 18297010 DE77, a DH10Bac-derived strain Bac-to-Bac system, Thermo Fisher N/A Chemicals, peptides, and recombinant proteins DMEM - Dulbecco’s Modified Eagle Medium ThermoFisher Scientific Cat# 11965-092 Fetal Bovine Serum Gemini Cat# 100-106 Penicillin-Streptomycin ThermoFisher Scientific Cat# 15140-122 Trypsin-EDTA (0.05%) ThermoFisher Scientific Cat# 25300054 cOmplete Mini, EDTA-free (protease inhibitor cocktail) Roche Cat# 11836170001 Recombinant Human TOP3B (Saha et al., 2020) N/A PEI Polysciences Cat# 23966 Lipofectamine 3000 Reagent ThermoFisher Scientific Cat# L3000015 Lipofectamine RNAiMAX transfection reagent ThermoFisher Scientific Cat# 13778150 Benzonase Sigma-Aldrich Cat# E8263 PierceTM ChIP-grade Protein A/G Magnetic Beads ThermoFisher Scientific Cat# 26162 Tris-glycine SDS sample buffer Novex Cat# LC2676 SuperSignalTM West Femto Maximum Sensitivity Substrate ThermoFisher Scientific Cat# 34095 (Continued on next page) e1 Cell Reports 40, 111067, July 12, 2022 .. REAGENT or RESOURCE SOURCE IDENTIFIER TRIzolTM Reagent ThermoFisher Scientific Cat# 15596026 Micrococcal Nuclease Solution (R100 U/mL) ThermoFisher Scientific Cat# 88216 RNase A ThermoFisher Scientific Cat# EN0531 RNase T1 ThermoFisher Scientific Cat# EN0542 RNase H New England Biolabs Cat# M0297L ShortCut RNase III New England BioLabs Cat# M0245L InvitrogenTM TURBOTM DNase (2 U/mL) ThermoFisher Scientific Cat# AM2238 N-Ethylmaleimide Millipore Sigma Cat# E3876-25G DNAzol ThermoFisher Scientific Cat# 10503027 Glycogen, RNA grade ThermoFisher Scientific Cat# R0551 InvitrogenTM Proteinase K Solution ThermoFisher Scientific Cat# 4333793 InvitrogenTM Proteinase K Solution (20 mg/mL), RNA grade ThermoFisher Scientific Cat# 25530049 N-Lauroylsarcosine sodium salt Millipore Sigma Cat# L9150 Camptothecin (CPT) Developmental Therapeutics Program (NCI/NIH) NSC#94600 Pladienolide B, 0.5 mg (CAS 445493-23-2) Santa Cruz Biotechnology Cat# sc-391691 GibcoTM Hygromycin B (50mg/mL) ThermoFisher Scientific Cat# 10-687-010 DDX5 (NM_004396) Human Recombinant Protein OriGene Cat# TP300371 Mini Quick Spin Oligo Columns Millipore Sigma Cat# 11814397001 Critical commercial assays MycoAlert kit - 100 tests Lonza Cat# LT07-318 Deposited data Original imaging data This paper: Mendeley Data https://data.mendeley.com/ datasets/htjp2m4sdb/draft? a=f39bb027-f618-4d44-a18b2c36fae27413 Experimental models: Cell lines HEK293 ATCC CRL-1573 HCT116 Developmental Therapeutics Program (NCI/NIH) N/A

    Chromatin Immunoprecipitation:

    Article Title: Resolution of R-loops by topoisomerase III-β (TOP3B) in coordination with the DEAD-box helicase DDX5.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Monoclonal ANTI-FLAG M2 Mouse Monoclonal antibody, Sigma-Aldrich Sigma-Aldrich Cat# F1804; RRID: AB_262044 Anti-GAPDH Rabbit Monoclonal Antibody, Unconjugated, Clone 14C10 Cell Signaling Technology Cat# 2118; RRID: AB_561053 Anti-TOP3B Rabbit Monoclonal antibody [EP7779] - C-terminal (ab183520) Abcam RRID: AB_183520 Rabbit Anti-HA-Tag Monoclonal Antibody, Unconjugated, Clone C29F4 Cell Signaling Technology Cat# 3724; RRID: AB_1549585 Sheep Anti-Mouse IgG ECL Antibody, HRP Conjugated, GE Healthcare GE Healthcare Cat# NA9310-1mL; RRID: AB_772193 Donkey Anti-Rabbit IgG ECL Antibody, HRP Conjugated, GE Healthcare GE Healthcare Cat# NA9340-1mL; RRID: AB_772191 Anti-dsRNA monoclonal antibody J2 (mouse, IgG2a, kappa chain) Jena Bioscience Cat# RNT-SCI-10010200; RRID: AB_2651015 Anti-DNA-RNA Hybrid Antibody, clone S9.6 Millipore Sigma Cat# MABE1095; RRID: AB_2861387 Recombinant Anti-DDX5 antibody [EPR7239] (ab126730) Abcam RRID: AB_126730 Recombinant Anti-Senataxin antibody [BLR050F] - BSA free (ab243904) Abcam Cat# ab243904; RRID: AB_2893218 TDRD3 (D3O2G) Rabbit mAb #5942 Cell Signaling Technology Cat# 5942; RRID: AB_2797626 HDAC1 (D5C6U) XP Rabbit mAb #34589 Cell Signaling Technology Cat# 34589S; RRID: AB_2756821 Histone H3 Rabbit Antibody #9715 Cell Signaling Technology Cat# 9715S; RRID: AB_331563 Bacterial and virus strains NEB 5-alpha Competent E. coli (High Efficiency) NEW ENGLAND BioLabs Inc. Cat# C2987H MAX EfficiencyTM DH10B Competent Cells ThermoFisher Scientific Cat# 18297010 DE77, a DH10Bac-derived strain Bac-to-Bac system, Thermo Fisher N/A Chemicals, peptides, and recombinant proteins DMEM - Dulbecco’s Modified Eagle Medium ThermoFisher Scientific Cat# 11965-092 Fetal Bovine Serum Gemini Cat# 100-106 Penicillin-Streptomycin ThermoFisher Scientific Cat# 15140-122 Trypsin-EDTA (0.05%) ThermoFisher Scientific Cat# 25300054 cOmplete Mini, EDTA-free (protease inhibitor cocktail) Roche Cat# 11836170001 Recombinant Human TOP3B (Saha et al., 2020) N/A PEI Polysciences Cat# 23966 Lipofectamine 3000 Reagent ThermoFisher Scientific Cat# L3000015 Lipofectamine RNAiMAX transfection reagent ThermoFisher Scientific Cat# 13778150 Benzonase Sigma-Aldrich Cat# E8263 PierceTM ChIP-grade Protein A/G Magnetic Beads ThermoFisher Scientific Cat# 26162 Tris-glycine SDS sample buffer Novex Cat# LC2676 SuperSignalTM West Femto Maximum Sensitivity Substrate ThermoFisher Scientific Cat# 34095 (Continued on next page) e1 Cell Reports 40, 111067, July 12, 2022 .. REAGENT or RESOURCE SOURCE IDENTIFIER TRIzolTM Reagent ThermoFisher Scientific Cat# 15596026 Micrococcal Nuclease Solution (R100 U/mL) ThermoFisher Scientific Cat# 88216 RNase A ThermoFisher Scientific Cat# EN0531 RNase T1 ThermoFisher Scientific Cat# EN0542 RNase H New England Biolabs Cat# M0297L ShortCut RNase III New England BioLabs Cat# M0245L InvitrogenTM TURBOTM DNase (2 U/mL) ThermoFisher Scientific Cat# AM2238 N-Ethylmaleimide Millipore Sigma Cat# E3876-25G DNAzol ThermoFisher Scientific Cat# 10503027 Glycogen, RNA grade ThermoFisher Scientific Cat# R0551 InvitrogenTM Proteinase K Solution ThermoFisher Scientific Cat# 4333793 InvitrogenTM Proteinase K Solution (20 mg/mL), RNA grade ThermoFisher Scientific Cat# 25530049 N-Lauroylsarcosine sodium salt Millipore Sigma Cat# L9150 Camptothecin (CPT) Developmental Therapeutics Program (NCI/NIH) NSC#94600 Pladienolide B, 0.5 mg (CAS 445493-23-2) Santa Cruz Biotechnology Cat# sc-391691 GibcoTM Hygromycin B (50mg/mL) ThermoFisher Scientific Cat# 10-687-010 DDX5 (NM_004396) Human Recombinant Protein OriGene Cat# TP300371 Mini Quick Spin Oligo Columns Millipore Sigma Cat# 11814397001 Critical commercial assays MycoAlert kit - 100 tests Lonza Cat# LT07-318 Deposited data Original imaging data This paper: Mendeley Data https://data.mendeley.com/ datasets/htjp2m4sdb/draft? a=f39bb027-f618-4d44-a18b2c36fae27413 Experimental models: Cell lines HEK293 ATCC CRL-1573 HCT116 Developmental Therapeutics Program (NCI/NIH) N/A

    Magnetic Beads:

    Article Title: Resolution of R-loops by topoisomerase III-β (TOP3B) in coordination with the DEAD-box helicase DDX5.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Monoclonal ANTI-FLAG M2 Mouse Monoclonal antibody, Sigma-Aldrich Sigma-Aldrich Cat# F1804; RRID: AB_262044 Anti-GAPDH Rabbit Monoclonal Antibody, Unconjugated, Clone 14C10 Cell Signaling Technology Cat# 2118; RRID: AB_561053 Anti-TOP3B Rabbit Monoclonal antibody [EP7779] - C-terminal (ab183520) Abcam RRID: AB_183520 Rabbit Anti-HA-Tag Monoclonal Antibody, Unconjugated, Clone C29F4 Cell Signaling Technology Cat# 3724; RRID: AB_1549585 Sheep Anti-Mouse IgG ECL Antibody, HRP Conjugated, GE Healthcare GE Healthcare Cat# NA9310-1mL; RRID: AB_772193 Donkey Anti-Rabbit IgG ECL Antibody, HRP Conjugated, GE Healthcare GE Healthcare Cat# NA9340-1mL; RRID: AB_772191 Anti-dsRNA monoclonal antibody J2 (mouse, IgG2a, kappa chain) Jena Bioscience Cat# RNT-SCI-10010200; RRID: AB_2651015 Anti-DNA-RNA Hybrid Antibody, clone S9.6 Millipore Sigma Cat# MABE1095; RRID: AB_2861387 Recombinant Anti-DDX5 antibody [EPR7239] (ab126730) Abcam RRID: AB_126730 Recombinant Anti-Senataxin antibody [BLR050F] - BSA free (ab243904) Abcam Cat# ab243904; RRID: AB_2893218 TDRD3 (D3O2G) Rabbit mAb #5942 Cell Signaling Technology Cat# 5942; RRID: AB_2797626 HDAC1 (D5C6U) XP Rabbit mAb #34589 Cell Signaling Technology Cat# 34589S; RRID: AB_2756821 Histone H3 Rabbit Antibody #9715 Cell Signaling Technology Cat# 9715S; RRID: AB_331563 Bacterial and virus strains NEB 5-alpha Competent E. coli (High Efficiency) NEW ENGLAND BioLabs Inc. Cat# C2987H MAX EfficiencyTM DH10B Competent Cells ThermoFisher Scientific Cat# 18297010 DE77, a DH10Bac-derived strain Bac-to-Bac system, Thermo Fisher N/A Chemicals, peptides, and recombinant proteins DMEM - Dulbecco’s Modified Eagle Medium ThermoFisher Scientific Cat# 11965-092 Fetal Bovine Serum Gemini Cat# 100-106 Penicillin-Streptomycin ThermoFisher Scientific Cat# 15140-122 Trypsin-EDTA (0.05%) ThermoFisher Scientific Cat# 25300054 cOmplete Mini, EDTA-free (protease inhibitor cocktail) Roche Cat# 11836170001 Recombinant Human TOP3B (Saha et al., 2020) N/A PEI Polysciences Cat# 23966 Lipofectamine 3000 Reagent ThermoFisher Scientific Cat# L3000015 Lipofectamine RNAiMAX transfection reagent ThermoFisher Scientific Cat# 13778150 Benzonase Sigma-Aldrich Cat# E8263 PierceTM ChIP-grade Protein A/G Magnetic Beads ThermoFisher Scientific Cat# 26162 Tris-glycine SDS sample buffer Novex Cat# LC2676 SuperSignalTM West Femto Maximum Sensitivity Substrate ThermoFisher Scientific Cat# 34095 (Continued on next page) e1 Cell Reports 40, 111067, July 12, 2022 .. REAGENT or RESOURCE SOURCE IDENTIFIER TRIzolTM Reagent ThermoFisher Scientific Cat# 15596026 Micrococcal Nuclease Solution (R100 U/mL) ThermoFisher Scientific Cat# 88216 RNase A ThermoFisher Scientific Cat# EN0531 RNase T1 ThermoFisher Scientific Cat# EN0542 RNase H New England Biolabs Cat# M0297L ShortCut RNase III New England BioLabs Cat# M0245L InvitrogenTM TURBOTM DNase (2 U/mL) ThermoFisher Scientific Cat# AM2238 N-Ethylmaleimide Millipore Sigma Cat# E3876-25G DNAzol ThermoFisher Scientific Cat# 10503027 Glycogen, RNA grade ThermoFisher Scientific Cat# R0551 InvitrogenTM Proteinase K Solution ThermoFisher Scientific Cat# 4333793 InvitrogenTM Proteinase K Solution (20 mg/mL), RNA grade ThermoFisher Scientific Cat# 25530049 N-Lauroylsarcosine sodium salt Millipore Sigma Cat# L9150 Camptothecin (CPT) Developmental Therapeutics Program (NCI/NIH) NSC#94600 Pladienolide B, 0.5 mg (CAS 445493-23-2) Santa Cruz Biotechnology Cat# sc-391691 GibcoTM Hygromycin B (50mg/mL) ThermoFisher Scientific Cat# 10-687-010 DDX5 (NM_004396) Human Recombinant Protein OriGene Cat# TP300371 Mini Quick Spin Oligo Columns Millipore Sigma Cat# 11814397001 Critical commercial assays MycoAlert kit - 100 tests Lonza Cat# LT07-318 Deposited data Original imaging data This paper: Mendeley Data https://data.mendeley.com/ datasets/htjp2m4sdb/draft? a=f39bb027-f618-4d44-a18b2c36fae27413 Experimental models: Cell lines HEK293 ATCC CRL-1573 HCT116 Developmental Therapeutics Program (NCI/NIH) N/A

    Subcloning:

    Article Title: Metabolic priming by multiple enzyme systems supports glycolysis, HIF1α stabilisation, and human cancer cell survival in early hypoxia.
    Article Snippet: .. Reagents and tools table Reagent/resource Reference or source Identifier or catalogue # Antibodies Mouse anti-β-Actin SigmaAldrich Cat# A2228; RRID:AB_476697 Rabbit anti-GLUT1 Millipore Cat# 07-1401; RRID:AB_1587074 Rabbit anti-GAPDH Cell Signaling Technology Cat# 2118; RRID:AB_561053 Rabbit anti-GOT1 Proteintech Group Cat# 14886-1-AP; RRID:AB_2113630 Rabbit anti-HA, Clone C29F4 Cell Signaling Technology Cat# 3724; RRID:AB_1549585 Mouse anti-HIF1α, Clone 54 BD Biosciences Cat# 610958; RRID:AB_398271 Rabbit anti-HIF-2α Abcam Cat# ab199; RRID:AB_302739 Rabbit anti-HK2, Clone C64G5 Cell Signaling Technology Cat# 2867; RRID:AB_2232946 Rabbit anti-hydroxy-HIF1α Pro564, Clone D43B5 Cell Signaling Technology Cat# 3434S; RRID:AB_2116958 Rabbit anti-LDHA Cell Signaling Technology Cat# 2012S; RRID:AB_2137173 Rabbit anti-MDH1 Atlas Antibodies Cat# HPA027296; RRID:AB_10611118 Rabbit anti-PDH2, Clone D31E11 Cell Signaling Technology Cat# 4835S; RRID:AB_10561316 Rabbit anti-PDHE-1α pSer293 Abcam Cat# ab92696; RRID:AB_10711672 Rabbit anti-PDK1, Clone C47H1 Cell Signaling Technology Cat# 3820; RRID:AB_1904078 Rabbit anti-PKM2, Clone D78A4 Cell Signaling Technology Cat# 4053; RRID:AB_1904096 Mouse anti-Tubulin, Clone DM1A SigmaAldrich Cat# T9026; RRID:AB_477593 Goat anti-rabbit IgG antibody conjugated to HRP Millipore Cat# AP132P Goat anti-mouse IgG antibody conjugated to HRP Millipore Cat# AP127P Bacterial strains Subcloning efficiency DH5α competent cells Thermo Fisher Scientific Cat# 18265017 © The Author(s) The EMBO Journal Volume 43 | Issue 8 | April 2024 | 1545 – 1569 1559 D ow nloaded from https://w w w .em bopress.org on A pril 24, 2024 from IP 114.4.213.208. .. Reagent/resource Reference or source Identifier or catalogue # Experimental models: cell lines Human: MCF7 ATCC Cat# CRL-12584; RRID:CVCL_0031 Human: MCF10A ATCC Cat# CRL-10317; RRID:CVCL_0598 Human: HEK-293T ATCC Cat# CRL-321; RRID:CVCL_0063 Human: MDA- MC-231 ATCC Cat# CRM-HTB26; RRID:CVCL_0062 Human: BT-474 ATCC Cat# HTB-20; RRID:CVCL_0179 Oligonucleotides Forward primer GOT1 cDNA amplification: cgcacgcgtaccATGGCACCTCCGTCAGTC This study N/A Reverse primer GOT1 cDNA amplification: gcgctcgagCTGGATTTTGGTGACTGCTTC This study N/A Forward primer LDHA cDNA amplification: cgcacgcgtaccATGGCAACTCTAAAGGATCAG This study N/A Reverse primer LDHA cDNA amplification: gcgctcgagAAATTGCAGCTCCTTTTGGATC This study N/A Forward primer HIF1α CRISPR sgRNA: caccgTTCTTTACTTCGCCGAGATC This study N/A Reverse primer HIF1α CRISPR sgRNA: aaacGATCTCGGCGAAGTAAAGAAc This study N/A Forward primer GOT1 CRISPR sgRNA: caccgAGTCTTTGCCGAGGTTCCGC This study N/A Reverse primer GOT1 CRISPR sgRNA: aaacGCGGAACCTCGGCAAAGACTc This study N/A Forward primer LHDA CRISPR sgRNA: caccGGCTGGGGCACGTCAGCAAG This study N/A Reverse primer LHDA CRISPR sgRNA: aaacCTTGCTGACGTGCCCCAGCC This study N/A Forward primer HIF1α knockout validation: TTCCATCTCGTGTTTTTCTTGTTGT This study N/A Reverse primer HIF1α knockout validation: CAAAACATTGCGACCACCTTCT This study N/A M13 forward primer: TGTAAAACGACGGCCAGT This study N/A Recombinant DNA pMSCV-Peredox-mCherry-NLS Addgene Cat# 32385 pSpCas9(BB)-2A-Puro (PX459) V2.0 Addgene Cat# 62988 pUC57-LbNOX Addgene Cat# 75285 pLenti-HA-IRES-BSD Origene Cat# PS100104 pLenti-GFP-P2A-BSD Origene Cat# PS100103 pOTB7-GOT1 Dharmacon Clone ID: BC000498 pDNR-LIB-LDHA Dharmacon Clone ID: BC067223 Software and algorithms Prism v7.0c GraphPad Software N/A Chemstation Agilent N/A Masshunter Agilent N/A Xcalibur QualBrowser Thermo Fisher Scientific N/A Tracefinder v4.1 Thermo Fisher Scientific N/A Cell lines and cell culture Cell lines (MCF7, female, ATCC Cat# CRL-12584, RRID:CVCL_0031; MCF10A, female, ATCC Cat# CRL-10317, RRID:CVCL_0598; HEK293T, female, ATCC Cat# CRL-3216, RRID:CVCL_0063; MDA-MB231, female, ATCC Cat# CRM-HTB-26, RRID:CVCL_0062; BT-474, female, ATCC Cat# HTB-20, RRID:CVCL_0179) were obtained from the American Type Culture Collection (ATCC, Manassas, VA, USA).

    other:

    Article Title: An optimized CRISPR/Cas9 approach for precise genome editing in neurons
    Article Snippet: WPRE.bGH RRID:addgene_105530 RRID:Addgene_105530 Biological sample (M. musculus) Primary neuron culture isolated from E18 mouse embryo and cultured Biological sample (R. norvegicus) Primary neuron culture isolated from E18 rat embryo and cultured Antibody Anti-GluA1 (Rabbit polyclonal) Homemade JH4294 IF (1:200) Antibody Anti-GluA2/3 (Rabbit polyclonal) Homemade JH4854 IF (1:250) Antibody Anti-GluA2 (mouse monoclonal) Eric Gouaux Lab clone 15F1 IF (1:5000) Antibody Anti-GluN1 (mouse monoclonal) NeuroMab, clone N308/48 UC Davis/NIH NeuroMab Facility Cat# N308/48, RRID:AB_2877408 IF (1:200) Antibody Anti-GluN2a (Rabbit polyclonal) Homemade JH6097 IF (1:200) Antibody Anti-GluN2b (Rabbit polyclonal) Millipore, AB1548 Millipore Cat# AB1548, RRID:AB_90759 IF (1:100) Antibody Anti-beta2 (mouse monoclonal) Millipore, MAB341 Millipore Cat# MAB341, RRID:AB_2109419 IF (1:200) Antibody Anti-PSD95 (mouse monoclonal) NeuroMab, clone K28/43 UC Davis/NIH NeuroMab Facility Cat# K28/43, RRID: AB_2877189 IF (1:2500) Antibody Anti-Gephyrin (mouse monoclonal) Synaptic systems, cat# 147011 Synaptic Systems Cat# 147 011, RRID:AB_887717 IF (1:2500) Antibody Anti-GFP (chicken polyclonal) Abcam, cat # ab13970 (Abcam Cat# ab13970, RRID:AB_300798) IHC (1:5000) Antibody Anti-GFP (chicken polyclonal) AVES, cat# GFP-1020 Aves Labs Cat# GFP-1020, RRID:AB_10000240 IF (1:5000) Antibody Anti-myc (mouse monoclonal) Homemade Clone 9E10 IF (1:1000) Antibody Anti-HA (Rabbit monoclonal) Cell Signaling, clone C29F4 Cell Signaling Technology Cat# 3724, RRID:AB_ 1549585 IF (1:500) Recombinant DNA reagent (Escherichia coli) pSG This paper For the guide2 cloning Recombinant DNA reagent (Streptococcus pyogenes) GluA1 (px330:2-guideCas9) This paper Twoguides for GluA1 (mouse) in px330 Recombinant DNA reagent (Mus musculus) pMiniT:SEP-GluA1 TKIT donor This paper TKIT donor for SEP-GluA1 (mouse) in pMiniT Recombinant DNA reagent (Mus musculus) pMiniT:myc-GluA1 TKIT donor This paper TKIT donor for myc-GluA1 (mouse) in pMiniT Recombinant DNA reagent (Streptococcus pyogenes) GluA2 (px330:2-guideCas9) This paper Two guides for GluA2 (mouse) in px330 Recombinant DNA reagent (Mus musculus) pMiniT:SEP-GluA2 TKIT donor This paper TKIT donor for SEP-GluA2 (mouse) in pMiniT Recombinant DNA reagent (Mus musculus) pMiniT:tdTomato-GluA2 TKIT donor This paper TKIT donor for tdTomatoGluA2 (mouse) in pMiniT Continued on next page Fang, Bygrave, et al. eLife 2021;10:e65202.



    Similar Products

    86
    Cell Signaling Technology Inc ha tag c29f4 rabbit mab cell signaling technology 3724s wb
    Ha Tag C29f4 Rabbit Mab Cell Signaling Technology 3724s Wb, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/c29f4+cell+signaling+technology/pm41736094-318-56-60
    Average 86 stars, based on 1 article reviews
    ha tag c29f4 rabbit mab cell signaling technology 3724s wb - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    99
    Cell Signaling Technology Inc ha 1 1000 rabbit monoclonal c29f4 3724 cell signaling technology rrid ab 1549585
    Progranulin interacts with acid sphingomyelinase but not neutral sphingomyelinase 2. A , HEK293T cells were transfected with HA-GRN (GRN) and either ASMase-FLAG (ASM) or nSMase2-FLAG (nSM2), then immunoprecipitated with <t>anti-HA.</t> Co-immunoprecipitation of ASMase-FLAG, but not nSMase2-FLAG, indicates progranulin binding with ASMase but not nSMase2. Full-length blot in . B-E , Proximity ligation assay in GRN -WT and GRN -KO HEK293 cells transfected with ASMase-FLAG or nSMase-FLAG, using anti-progranulin (endogenous) and anti-FLAG antibodies. There were numerous PLA puncta with GRN-ASMase but not with GRN-nSMase2. GRN -WT, progranulin wildtype HEK293 cells; GRN -KO, progranulin knockout HEK293 cells. Scale bar = 10 μm.
    Ha 1 1000 Rabbit Monoclonal C29f4 3724 Cell Signaling Technology Rrid Ab 1549585, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/c29f4+cell+signaling+technology/HA-Tag+Rabbit+mAb/pmc12320091-181-5-11
    Average 99 stars, based on 1 article reviews
    ha 1 1000 rabbit monoclonal c29f4 3724 cell signaling technology rrid ab 1549585 - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    Cell Signaling Technology Inc ab 490778 ha rabbit monoclonal anti ha tag c29f4 cell signaling technology
    Progranulin interacts with acid sphingomyelinase but not neutral sphingomyelinase 2. A , HEK293T cells were transfected with HA-GRN (GRN) and either ASMase-FLAG (ASM) or nSMase2-FLAG (nSM2), then immunoprecipitated with <t>anti-HA.</t> Co-immunoprecipitation of ASMase-FLAG, but not nSMase2-FLAG, indicates progranulin binding with ASMase but not nSMase2. Full-length blot in . B-E , Proximity ligation assay in GRN -WT and GRN -KO HEK293 cells transfected with ASMase-FLAG or nSMase-FLAG, using anti-progranulin (endogenous) and anti-FLAG antibodies. There were numerous PLA puncta with GRN-ASMase but not with GRN-nSMase2. GRN -WT, progranulin wildtype HEK293 cells; GRN -KO, progranulin knockout HEK293 cells. Scale bar = 10 μm.
    Ab 490778 Ha Rabbit Monoclonal Anti Ha Tag C29f4 Cell Signaling Technology, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/c29f4+cell+signaling+technology/HA-Tag+Rabbit+mAb/pmc12391048__Table_3-3-69-75
    Average 99 stars, based on 1 article reviews
    ab 490778 ha rabbit monoclonal anti ha tag c29f4 cell signaling technology - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    Cell Signaling Technology Inc ha cell signaling technology c29f4 3724
    Progranulin interacts with acid sphingomyelinase but not neutral sphingomyelinase 2. A , HEK293T cells were transfected with HA-GRN (GRN) and either ASMase-FLAG (ASM) or nSMase2-FLAG (nSM2), then immunoprecipitated with <t>anti-HA.</t> Co-immunoprecipitation of ASMase-FLAG, but not nSMase2-FLAG, indicates progranulin binding with ASMase but not nSMase2. Full-length blot in . B-E , Proximity ligation assay in GRN -WT and GRN -KO HEK293 cells transfected with ASMase-FLAG or nSMase-FLAG, using anti-progranulin (endogenous) and anti-FLAG antibodies. There were numerous PLA puncta with GRN-ASMase but not with GRN-nSMase2. GRN -WT, progranulin wildtype HEK293 cells; GRN -KO, progranulin knockout HEK293 cells. Scale bar = 10 μm.
    Ha Cell Signaling Technology C29f4 3724, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/c29f4+cell+signaling+technology/HA-Tag+Rabbit+mAb/bio_rxiv__2025__07__14__663986-296-17-18
    Average 99 stars, based on 1 article reviews
    ha cell signaling technology c29f4 3724 - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    Cell Signaling Technology Inc ha c29f4 cell signaling technology 3724
    Progranulin interacts with acid sphingomyelinase but not neutral sphingomyelinase 2. A , HEK293T cells were transfected with HA-GRN (GRN) and either ASMase-FLAG (ASM) or nSMase2-FLAG (nSM2), then immunoprecipitated with <t>anti-HA.</t> Co-immunoprecipitation of ASMase-FLAG, but not nSMase2-FLAG, indicates progranulin binding with ASMase but not nSMase2. Full-length blot in . B-E , Proximity ligation assay in GRN -WT and GRN -KO HEK293 cells transfected with ASMase-FLAG or nSMase-FLAG, using anti-progranulin (endogenous) and anti-FLAG antibodies. There were numerous PLA puncta with GRN-ASMase but not with GRN-nSMase2. GRN -WT, progranulin wildtype HEK293 cells; GRN -KO, progranulin knockout HEK293 cells. Scale bar = 10 μm.
    Ha C29f4 Cell Signaling Technology 3724, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/c29f4+cell+signaling+technology/HA-Tag+Rabbit+mAb/pmc12463049-367-57-59
    Average 99 stars, based on 1 article reviews
    ha c29f4 cell signaling technology 3724 - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    Cell Signaling Technology Inc c29f4 cell signaling technology
    Progranulin interacts with acid sphingomyelinase but not neutral sphingomyelinase 2. A , HEK293T cells were transfected with HA-GRN (GRN) and either ASMase-FLAG (ASM) or nSMase2-FLAG (nSM2), then immunoprecipitated with <t>anti-HA.</t> Co-immunoprecipitation of ASMase-FLAG, but not nSMase2-FLAG, indicates progranulin binding with ASMase but not nSMase2. Full-length blot in . B-E , Proximity ligation assay in GRN -WT and GRN -KO HEK293 cells transfected with ASMase-FLAG or nSMase-FLAG, using anti-progranulin (endogenous) and anti-FLAG antibodies. There were numerous PLA puncta with GRN-ASMase but not with GRN-nSMase2. GRN -WT, progranulin wildtype HEK293 cells; GRN -KO, progranulin knockout HEK293 cells. Scale bar = 10 μm.
    C29f4 Cell Signaling Technology, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/c29f4+cell+signaling+technology/HA-Tag+Rabbit+mAb/pmc11551378__pnas__2408345121__sapp2-2-8-9
    Average 99 stars, based on 1 article reviews
    c29f4 cell signaling technology - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    Cell Signaling Technology Inc rrid : ab 2572291 ha tag c29f4 rabbit mab cell signaling technology
    Progranulin interacts with acid sphingomyelinase but not neutral sphingomyelinase 2. A , HEK293T cells were transfected with HA-GRN (GRN) and either ASMase-FLAG (ASM) or nSMase2-FLAG (nSM2), then immunoprecipitated with <t>anti-HA.</t> Co-immunoprecipitation of ASMase-FLAG, but not nSMase2-FLAG, indicates progranulin binding with ASMase but not nSMase2. Full-length blot in . B-E , Proximity ligation assay in GRN -WT and GRN -KO HEK293 cells transfected with ASMase-FLAG or nSMase-FLAG, using anti-progranulin (endogenous) and anti-FLAG antibodies. There were numerous PLA puncta with GRN-ASMase but not with GRN-nSMase2. GRN -WT, progranulin wildtype HEK293 cells; GRN -KO, progranulin knockout HEK293 cells. Scale bar = 10 μm.
    Rrid : Ab 2572291 Ha Tag C29f4 Rabbit Mab Cell Signaling Technology, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/c29f4+cell+signaling+technology/DYKDDDDK+Tag+Rabbit+mAb/pm40503938-250-27-32
    Average 99 stars, based on 1 article reviews
    rrid : ab 2572291 ha tag c29f4 rabbit mab cell signaling technology - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    Cell Signaling Technology Inc ha tag c29f4 rabbit mab cell signaling technology
    Progranulin interacts with acid sphingomyelinase but not neutral sphingomyelinase 2. A , HEK293T cells were transfected with HA-GRN (GRN) and either ASMase-FLAG (ASM) or nSMase2-FLAG (nSM2), then immunoprecipitated with <t>anti-HA.</t> Co-immunoprecipitation of ASMase-FLAG, but not nSMase2-FLAG, indicates progranulin binding with ASMase but not nSMase2. Full-length blot in . B-E , Proximity ligation assay in GRN -WT and GRN -KO HEK293 cells transfected with ASMase-FLAG or nSMase-FLAG, using anti-progranulin (endogenous) and anti-FLAG antibodies. There were numerous PLA puncta with GRN-ASMase but not with GRN-nSMase2. GRN -WT, progranulin wildtype HEK293 cells; GRN -KO, progranulin knockout HEK293 cells. Scale bar = 10 μm.
    Ha Tag C29f4 Rabbit Mab Cell Signaling Technology, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/c29f4+cell+signaling+technology/HA-Tag+Rabbit+mAb/pm40330885-198-15-19
    Average 99 stars, based on 1 article reviews
    ha tag c29f4 rabbit mab cell signaling technology - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    Cell Signaling Technology Inc ha tag c29f4 rabbit cell signaling technology 3724s wb
    Progranulin interacts with acid sphingomyelinase but not neutral sphingomyelinase 2. A , HEK293T cells were transfected with HA-GRN (GRN) and either ASMase-FLAG (ASM) or nSMase2-FLAG (nSM2), then immunoprecipitated with <t>anti-HA.</t> Co-immunoprecipitation of ASMase-FLAG, but not nSMase2-FLAG, indicates progranulin binding with ASMase but not nSMase2. Full-length blot in . B-E , Proximity ligation assay in GRN -WT and GRN -KO HEK293 cells transfected with ASMase-FLAG or nSMase-FLAG, using anti-progranulin (endogenous) and anti-FLAG antibodies. There were numerous PLA puncta with GRN-ASMase but not with GRN-nSMase2. GRN -WT, progranulin wildtype HEK293 cells; GRN -KO, progranulin knockout HEK293 cells. Scale bar = 10 μm.
    Ha Tag C29f4 Rabbit Cell Signaling Technology 3724s Wb, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/c29f4+cell+signaling+technology/HA-Tag+Rabbit+mAb/pmc12049546__41467_2025_59504_MOESM1_ESM-155-185-188
    Average 99 stars, based on 1 article reviews
    ha tag c29f4 rabbit cell signaling technology 3724s wb - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    Image Search Results


    Progranulin interacts with acid sphingomyelinase but not neutral sphingomyelinase 2. A , HEK293T cells were transfected with HA-GRN (GRN) and either ASMase-FLAG (ASM) or nSMase2-FLAG (nSM2), then immunoprecipitated with anti-HA. Co-immunoprecipitation of ASMase-FLAG, but not nSMase2-FLAG, indicates progranulin binding with ASMase but not nSMase2. Full-length blot in . B-E , Proximity ligation assay in GRN -WT and GRN -KO HEK293 cells transfected with ASMase-FLAG or nSMase-FLAG, using anti-progranulin (endogenous) and anti-FLAG antibodies. There were numerous PLA puncta with GRN-ASMase but not with GRN-nSMase2. GRN -WT, progranulin wildtype HEK293 cells; GRN -KO, progranulin knockout HEK293 cells. Scale bar = 10 μm.

    Journal: Neurobiology of disease

    Article Title: Reduction of sphingomyelinase activity associated with progranulin deficiency and frontotemporal dementia

    doi: 10.1016/j.nbd.2025.107024

    Figure Lengend Snippet: Progranulin interacts with acid sphingomyelinase but not neutral sphingomyelinase 2. A , HEK293T cells were transfected with HA-GRN (GRN) and either ASMase-FLAG (ASM) or nSMase2-FLAG (nSM2), then immunoprecipitated with anti-HA. Co-immunoprecipitation of ASMase-FLAG, but not nSMase2-FLAG, indicates progranulin binding with ASMase but not nSMase2. Full-length blot in . B-E , Proximity ligation assay in GRN -WT and GRN -KO HEK293 cells transfected with ASMase-FLAG or nSMase-FLAG, using anti-progranulin (endogenous) and anti-FLAG antibodies. There were numerous PLA puncta with GRN-ASMase but not with GRN-nSMase2. GRN -WT, progranulin wildtype HEK293 cells; GRN -KO, progranulin knockout HEK293 cells. Scale bar = 10 μm.

    Article Snippet: The following antibodies were used: HA (1:1000, rabbit monoclonal, C29F4, #3724, Cell Signaling Technology, RRID: AB_1549585), FLAG (1:1000, mouse monoclonal, F3165, Sigma-Aldrich, RRID: AB_259529), nSMase2 (1:1000, mouse monoclonal, G-6, #sc-166,637, Santa Cruz Biotechnology, RRID: AB_2270817), GAPDH (1:5000, mouse monoclonal, 6C5, #MAB374, MilliporeSigma, RRID: AB_2107445).

    Techniques: Transfection, Immunoprecipitation, Binding Assay, Proximity Ligation Assay, Knock-Out